What sequence can I enter?

Enter a DNA oligonucleotide in the 5′→3′ direction using A, C, G, and T only. The allowed length is 4–200 nt.

Which Tm method does Auto use?

Auto uses the Wallace rule for sequences shorter than 14 nt and the salt-corrected formula for sequences of 14 nt or longer.

Why is sodium concentration required?

Sodium concentration is used by the salt-corrected formula and should represent total sodium or equivalent monovalent ion concentration in the buffer.

What formula is used for the salt-corrected estimate?

The calculator uses 81.5 + 16.6×log₁₀[Na⁺] + 0.41×(%G+C) − 600/n, with sodium concentration converted from mM to M.

Are these Tm values suitable for final primer design?

No. These are educational approximations and do not account for factors such as mismatches or formamide and DMSO.

Elysia Tools

Navigation

Education

Oligonucleotide Tm Calculator (Salt-Corrected)

Classic Tm rules for DNA oligos: Wallace 2(A+T)+4(G+C) under 14 nt and the Sambrook/Primer3 salt formula 81.5 + 16.6·log₁₀[Na⁺] + 0.41×(%G+C) − 600/n from 14 nt, with auto switching, GC%, composition, and both estimates side by side. Wallace 1979 / Sambrook 1989 derived. Educational use only.

Execution

Run this tool

Fill in the form, run the tool, and review the result in one place.

Prepared example runs

Click an example to fill the form automatically. File inputs still need an upload.

2 examples

20-mer ATGC repeat, 50 mM Na⁺ → salt-corrected Tm = 50.4 °C

The 20-mer ATGCATGCATGCATGCATGC (50% GC) at 50 mM sodium gives Tm = 81.5 + 16.6·log10(0.05) + 0.41×50 − 600/20 = 50.40 °C by the Sambrook formula — auto mode picks it because the oligo is ≥14 nt. The Wallace rule would claim 60 °C, showing how the salt-corrected estimate runs lower at low ionic strength; dropping salt to 20 mM moves the estimate below 45 °C.

{"result":"Tm ≈ 50.4 °C (salt-corrected, 50% GC, 20 nt, 50 mM Na⁺).","metadata":{"input":{"sequence":"ATGCATGCATGCATGCATGC","method":"auto","sodiumMm":50},"result":{"tmC":50.4,"methodUsed":"salt-corrected","gcPercent":50,"length":20,"wallaceTmC":60,"saltCorrectedTmC":50.4}}}

10-mer ACGTACGTAC → auto picks Wallace, Tm = 30 °C

A 10-mer probe (ACGTACGTAC, 50% GC) is too short for the salt formula's length term, so auto mode falls back to the Wallace rule: Tm = 2×5 + 4×5 = 30 °C. The example shows the length threshold switch and why sub-14-nt probes are poor hybridization probes — their duplexes barely survive at body temperature.

{"result":"Tm ≈ 30 °C (Wallace rule, 50% GC, 10 nt).","metadata":{"input":{"sequence":"ACGTACGTAC","method":"auto","sodiumMm":50},"result":{"tmC":32,"methodUsed":"wallace","gcPercent":60,"length":10,"wallaceTmC":32,"saltCorrectedTmC":20.4}}}

Inputs

Set the required fields, then run the tool.

4 options

ContentPaste or type the main input values.1

Oligonucleotide Sequence (5'→3')textRequiredDNA sequence, A/C/G/T only (spaces stripped, case-insensitive), 4–200 nt.

SettingsAdjust formats, ranges, numbers, and modes.3

Tm MethodselectRequiredAuto uses Wallace below 14 nt and the salt-corrected formula from 14 nt up.Sodium Concentration (mM)numberRequiredTotal [Na⁺] (or equivalent monovalent) of the buffer; used by the salt-corrected formula.Decimal PlacesnumberOptional

Result

Ready for a run

Run the tool to preview files, text, structured data, or streamed output here.

Samples

Oligonucleotide Tm Calculator (Salt-Corrected)

Run this tool

Prepared example runs

Inputs

Result

Examples that match this tool

Continue with connected tools and hubs

Prepared example runs

Inputs

Result

Learn when to use this tool, what it supports, and how real users apply it.

Key facts

Overview

When to use

How it works

Use cases

Examples

1. 20-mer with salt-corrected Tm

2. 10-mer using the Wallace rule

FAQ

Web Image Processing Python Samples

Android Image Processing Java Samples

Android Image Processing Kotlin Samples

Web Image Processing Rust Samples

PCR Annealing Temperature Calculator (Ta = Tm − 5°C)

Autosomal Dominant Pedigree Analyzer

Autosomal Recessive Inheritance Risk Calculator

Hemocytometer Cell Counter (cells/mL)

Audio Encoding and Format Conversion Tools

Image Format Conversion and Animated Export Tools

JSON Interchange and Format Translation Tools

Color Space Conversion Tools for Web and Print