Education
Classic Tm rules for DNA oligos: Wallace 2(A+T)+4(G+C) under 14 nt and the Sambrook/Primer3 salt formula 81.5 + 16.6·log₁₀[Na⁺] + 0.41×(%G+C) − 600/n from 14 nt, with auto switching, GC%, composition, and both estimates side by side. Wallace 1979 / Sambrook 1989 derived. Educational use only.
Call this tool from your code in three languages.
curl -X POST 'https://api.elysiatools.com/en/api/tools/oligo-melting-temperature' \
-H 'Content-Type: application/json' \
-d '{"sequence":"ATGCATGCATGCATGCATGC","method":"auto","sodiumMm":50,"decimalPlaces":2}'Send a POST request with your inputs as JSON. File parameters require a separate upload first.
POST https://api.elysiatools.com/en/api/tools/oligo-melting-temperature| Name | Type | Required | Description |
|---|---|---|---|
| sequence | text | Yes | DNA sequence, A/C/G/T only (spaces stripped, case-insensitive), 4–200 nt. |
| method | select | Yes | Auto uses Wallace below 14 nt and the salt-corrected formula from 14 nt up. |
| sodiumMm | number | Yes | Total [Na⁺] (or equivalent monovalent) of the buffer; used by the salt-corrected formula. |
| decimalPlaces | number | No | — |
JSON result
Add this tool to your Model Context Protocol server so AI agents can list and call it.
Add this block to your MCP client configuration:
{
"mcpServers": {
"elysiatools-oligo-melting-temperature": {
"name": "oligo-melting-temperature",
"description": "Classic Tm rules for DNA oligos: Wallace 2(A+T)+4(G+C) under 14 nt and the Sambrook/Primer3 salt formula 81.5 + 16.6·log₁₀[Na⁺] + 0.41×(%G+C) − 600/n from 14 nt, with auto switching, GC%, composition, and both estimates side by side. Wallace 1979 / Sambrook 1989 derived. Educational use only.",
"baseUrl": "https://api.elysiatools.com/mcp/sse?toolId=oligo-melting-temperature",
"command": "",
"args": [],
"env": {},
"isActive": true,
"type": "sse"
}
}
}After connecting to the SSE endpoint, list the exposed tools:
{
"jsonrpc": "2.0",
"id": 1,
"method": "tools/list"
}Invoke the tool by its id, passing arguments built from its parameters:
{
"jsonrpc": "2.0",
"id": 2,
"method": "tools/call",
"params": {
"name": "oligo-melting-temperature",
"arguments": {
"sequence": "ATGCATGCATGCATGCATGC",
"method": "auto",
"sodiumMm": 50,
"decimalPlaces": 2
}
}
}{
"key": {...},
"metadata": {
"key": "value"
},
"error": "Error message (optional)",
"message": "Notification message (optional)"
}Questions or issues? Contact [email protected]