Education
Oligonucleotide Tm Calculator (Salt-Corrected)
Classic Tm rules for DNA oligos: Wallace 2(A+T)+4(G+C) under 14 nt and the Sambrook/Primer3 salt formula 81.5 + 16.6·log₁₀[Na⁺] + 0.41×(%G+C) − 600/n from 14 nt, with auto switching, GC%, composition, and both estimates side by side. Wallace 1979 / Sambrook 1989 derived. Educational use only.
json· JSON resultOpen tool
Quick start
Call this tool from your code in three languages.
cURL
curl -X POST 'https://api.elysiatools.com/en/api/tools/oligo-melting-temperature' \
-H 'Content-Type: application/json' \
-d '{"sequence":"ATGCATGCATGCATGCATGC","method":"auto","sodiumMm":50,"decimalPlaces":2}'API reference
Send a POST request with your inputs as JSON. File parameters require a separate upload first.
Endpoint
HTTP
POST https://api.elysiatools.com/en/api/tools/oligo-melting-temperatureParameters
| Name | Type | Required | Description |
|---|---|---|---|
| sequence | text | Yes | DNA sequence, A/C/G/T only (spaces stripped, case-insensitive), 4–200 nt. |
| method | select | Yes | Auto uses Wallace below 14 nt and the salt-corrected formula from 14 nt up. |
| sodiumMm | number | Yes | Total [Na⁺] (or equivalent monovalent) of the buffer; used by the salt-corrected formula. |
| decimalPlaces | number | No | — |
Response format
JSON result
MCP integration
Add this tool to your Model Context Protocol server so AI agents can list and call it.
Server configuration
Add this block to your MCP client configuration:
mcp.json
{
"mcpServers": {
"elysiatools-oligo-melting-temperature": {
"name": "oligo-melting-temperature",
"description": "Classic Tm rules for DNA oligos: Wallace 2(A+T)+4(G+C) under 14 nt and the Sambrook/Primer3 salt formula 81.5 + 16.6·log₁₀[Na⁺] + 0.41×(%G+C) − 600/n from 14 nt, with auto switching, GC%, composition, and both estimates side by side. Wallace 1979 / Sambrook 1989 derived. Educational use only.",
"baseUrl": "https://api.elysiatools.com/mcp/sse?toolId=oligo-melting-temperature",
"command": "",
"args": [],
"env": {},
"isActive": true,
"type": "sse"
}
}
}List available tools
After connecting to the SSE endpoint, list the exposed tools:
tools/list
{
"jsonrpc": "2.0",
"id": 1,
"method": "tools/list"
}Call this tool
Invoke the tool by its id, passing arguments built from its parameters:
tools/call
{
"jsonrpc": "2.0",
"id": 2,
"method": "tools/call",
"params": {
"name": "oligo-melting-temperature",
"arguments": {
"sequence": "ATGCATGCATGCATGCATGC",
"method": "auto",
"sodiumMm": 50,
"decimalPlaces": 2
}
}
}Chain multiple tools in one session with a comma-separated toolId list, e.g. /mcp/sse?toolId=png-to-webp,jpg-to-webp,gif-to-webp (max 20).