Oligonucleotide Tm Calculator (Salt-Corrected)

Oligonucleotide Tm Calculator (Salt-Corrected) | Online Free Tool | Elysia Tools

Tool usage guide

Learn when to use this tool, what it supports, and how real users apply it.

Key facts

Category: Education
Input types: text, select, number
Output type: json
Sample coverage: 4
API ready: Yes

Overview

The Oligonucleotide Tm Calculator estimates DNA oligo melting temperature using the Wallace rule for short sequences or a salt-corrected formula for longer sequences. Enter a 5′→3′ DNA sequence, choose the calculation method, and provide sodium concentration to view Tm, GC percentage, length, base composition, and both estimates.

When to use

Estimate the melting temperature of a short DNA oligonucleotide or probe.
Compare Wallace and salt-corrected Tm estimates for the same sequence.
Check how GC content, oligo length, and sodium concentration affect an approximate Tm.

How it works

1Enter a DNA sequence containing only A, C, G, and T; spaces are removed and letter case is ignored.
2Choose Auto, Wallace rule, or the salt-corrected formula, then enter sodium concentration in mM.
3Auto mode uses the Wallace rule below 14 nt and the salt-corrected formula from 14 nt upward.
4The JSON result reports the selected Tm estimate, method used, GC percentage, sequence length, composition, and both calculated estimates.

Use cases

Quickly estimate hybridization temperatures for short DNA probes.
Review GC content and base composition while comparing oligo candidates.
Explore the effect of sodium concentration on a longer oligonucleotide’s approximate Tm.

Examples

1. 20-mer with salt-corrected Tm

Molecular biology student

Background

A student wants an approximate Tm for a 20-nt DNA oligonucleotide in a buffer containing 50 mM sodium.

Problem

The sequence is long enough for the salt-corrected formula, but the student also wants to compare it with the Wallace estimate.

How to use

Enter ATGCATGCATGCATGCATGC, keep the method set to Auto, enter 50 mM sodium, and use two decimal places.

Sequence: ATGCATGCATGCATGCATGC; Method: Auto; Sodium: 50 mM; Decimal places: 2

Outcome

The calculator selects the salt-corrected method and returns Tm ≈ 50.4 °C, 50% GC, 20 nt, with a Wallace estimate of 60 °C.

2. 10-mer using the Wallace rule

Teaching laboratory trainee

Background

A trainee is checking a short 10-nt DNA probe and wants to see how Auto mode handles sequences below the salt-formula threshold.

Problem

The probe is shorter than 14 nt, so Auto mode should use the Wallace rule.

How to use

Enter ACGTACGTAC, keep the method set to Auto, enter 50 mM sodium, and use two decimal places.

FAQ

What sequence can I enter?

Enter a DNA oligonucleotide in the 5′→3′ direction using A, C, G, and T only. The allowed length is 4–200 nt.

Which Tm method does Auto use?

Auto uses the Wallace rule for sequences shorter than 14 nt and the salt-corrected formula for sequences of 14 nt or longer.

Why is sodium concentration required?

Sodium concentration is used by the salt-corrected formula and should represent total sodium or equivalent monovalent ion concentration in the buffer.

What formula is used for the salt-corrected estimate?

The calculator uses 81.5 + 16.6×log₁₀[Na⁺] + 0.41×(%G+C) − 600/n, with sodium concentration converted from mM to M.

Are these Tm values suitable for final primer design?

No. These are educational approximations and do not account for factors such as mismatches or formamide and DMSO.

Sequence: ACGTACGTAC; Method: Auto; Sodium: 50 mM; Decimal places: 2

Run this tool

Examples that match this tool

Continue with connected tools and hubs

Learn when to use this tool, what it supports, and how real users apply it.

Key facts

Overview

When to use

How it works

Use cases

Examples

1. 20-mer with salt-corrected Tm

2. 10-mer using the Wallace rule

FAQ

Web Image Processing Python Samples

Android Image Processing Java Samples

Android Image Processing Kotlin Samples

Web Image Processing Rust Samples

Absorbance↔Transmittance Converter (A = −log₁₀T)

PCR Annealing Temperature Calculator (Ta = Tm − 5°C)

Autosomal Dominant Pedigree Analyzer

Autosomal Recessive Inheritance Risk Calculator